Volume 7, Issue 3 (Summer 2021)                   Caspian.J.Neurol.Sci 2021, 7(3): 172-179 | Back to browse issues page


XML Print


Download citation:
BibTeX | RIS | EndNote | Medlars | ProCite | Reference Manager | RefWorks
Send citation to:

Hedayati Ch M, Abedinzade M, Khanaki K, Khakpour Tleghani B, Golshekan M, Mohammadi E. Comparative Protective Effects of Viola Spathulata, Urtica Dioica, and Lamium Album on Endoplasmic Reticulum (ER) Stress in Rat Stroke Model. Caspian.J.Neurol.Sci. 2021; 7 (3) :172-179
URL: http://cjns.gums.ac.ir/article-1-442-en.html
1- Department of Microbiology, Faculty of Medicine, Guilan University of Medical Sciences, Rasht, Iran.
2- Department of Physiology, Faculty of Medicine, Guilan University of Medical Sciences, Rasht, Iran. , mabedinzade@gums.ac.ir
3- Department of Clinical Biochemistry, Faculty of Paramedicine, Guilan University of Medical Sciences, Rasht, Iran.
4- Cellular and Molecular Research Center, Faculty of Medicine, Guilan University of Medical Sciences, Rasht, Iran.
5- Medical Biotechnology Research Center, Faculty of Paramedicine, Guilan University of Medical Sciences, Rasht, Iran.
6- Department of Medical Physiology, School of Medicine, Iran University of Medical Sciences, Tehran, Iran.
Full-Text [PDF 1739 kb]   (179 Downloads)     |   Abstract (HTML)  (272 Views)
Full-Text:   (77 Views)

Introduction

Stroke is sudden rupture or obstruction of the brain artery or vein leading to localized brain damage or clinical neurological defect [1]. It is the most prevalent nervous system disease, the main reason for mental and physical disability in adults, and the third mortality cause in industrial countries [2, 3]. According to The World Health Organization (WHO), about 15 million strokes happen worldwide every year [3]. The prevalence of ischemic stroke is higher than its hemorrhagic type [1, 2, 4, 5]. The sudden decrease or lack of blood flow to an area of the brain leads to ischemic stroke that causes loss of neurological function in that area. Ischemic stroke is caused by embolism and thrombosis [6]. As described by Sacco, the different identified risk factors for ischemic stroke include age; gender; race/ethnicity; heredity; hypertension; heart disease, particularly atrial fibrillation; diabetes mellitus; hypercholesterolemia; smoking; and alcoholic drink over consumption [7]. Stroke is followed by various complications like body paralysis, sensory difficulties, psychopathy, and death [5]. More than 50 neuroprotective agents and chemical drugs like statins or aspirin have been identified to date in clinical studies on at-risk populations; however, none of them are fully effective [8, 9]. Sometimes dual antiplatelet therapy pretreatment was not effective for acute ischemic stroke [10]. 
The mechanism of disease is complex, and different molecular pathways play a role in ischemic stroke incidence. Brain tissue is susceptible to ischemic injury because of its high metabolism and low oxygen reserves [2]. Neuron inflammation is one of the essential pathological events in brain damage due to ischemia. Inflammatory changes in neurons can destruct the brain-blood barrier, cause edema, and, consequently, cell death [3]. Reperfusion is critical to establish normal brain function, but it can also cause secondary injury called Ischemia-Reperfusion (I-R) injury. In this injury, oxidative stress mediators such as reactive oxygen species are produced from inflammatory cells around the I-R region [4]. Considering that oxidative stress and inflammation are the main causes of neuron damage during ischemia, as well as the ineffectiveness of existing drugs in the treatment of ischemia, efforts are made to promote antioxidant drugs. There are different signaling during stress and inflammation within intracellular organelles. The Endoplasmic Reticulum (ER) stress can lead to protein folding disturbance [5]. Aggregation of unfolded proteins results in Unfolded Protein Response (UPR) and activates ER stress sensor Inositol-Requiring Enzyme 1 (IRE-1) [5]. Ischemia and hypoxia cause ER stress and neuronal death [6]. IRE-1 sensor signaling and increased IRE-1-mediated splicing of XBP-1 mRNA exhibited a neuroprotective effect in a rat model of focal cerebral ischemia [7]. Meanwhile, the UPR activation can determine cell faith, i.e., survival (adaptive UPR) or fatal (terminal UPR). IRE-1-mediated splicing of the XBP-1 mRNA route for the inflammatory and neuroinflammatory disease have been investigated as described before [8, 9]. Searching for new neuroprotective prescriptions with anti-inflammatory and anti-neuroinflammatory effects seems to be useful [10]. 
The use of plants in the treatment of diseases is as old as history. However, in recent years, many researchers have paid attention to medicinal herbs and their extracted materials. One of these herbs is L. album, which belongs to the Lamiaceae family and is commonly known as white dead nettle. Experimental studies have reported many medicinal properties of this plant, including anti-inflammatory [11], antioxidant and free radical scavenging [12], anticancer [13], and antidiabetic effects [14-16].
Another herb is U. dioica, which belongs to the Urticaceae family and is commonly known as stinging nettle. It is widely grown in Iran. Studies have reported many properties of this plant, including inflammatory [17], antioxidant [18], antihyperlipidemic [19], and neuroprotective effects [20]. The other plant is V. spathulata, which belongs to the Violaceae family which is mainly found in temperate regions of the world. This flower contains large amounts of melatonin. Reports indicate that most plants containing melatonin are traditionally used to treat neurological disorders or diseases associated with the production of free radicals [21]. These reports confirm the effect of melatonin as a neuroprotective agent [22]. A study has shown that melatonin has a protective role in brain ischemia induced by global ischemia [23]. 
This study aimed to compare the potential neuroprotective effects of V. spathulata, L. album, and U. dioica by considering the splicing number of XBP-1 in the brain of the ischemic rat stroke model.

Materials and Methods

Study animals
During this experimental study, adult male Wistar albino rats (weight: 220-250 g) were used. The selected animals were housed under normal laboratory conditions (12 h light: 12 h dark at 22-24°C) with free access to their appropriate diet and water. All procedures were performed following the internationally accepted principles for laboratory animal care and use as in the US guidelines (NIH publication #85-23, revised in 1985). 
Plant material and extraction
The plants L. album and U. dioica were collected from the Rasht region in Guilan Province, Iran. They were identified by Fatemeh Yousefbeyk, Department of Pharmacognosy, Guilan University of Medical Sciences, Iran (voucher Numbers 202HGUM and 156HGUM for L. album and U. dioica, respectively). For each plant, the hydroalcoholic extract was prepared by macerating the powder of stems and leaves in 50% ethanol (10 mL/g powder) for 72 h at 40°C. Then, the extracts were filtered through a 250-μm mesh, centrifuged at 2000 RPM for 10 min, and their supernatants were dried on a water bath (40°C) [24].
V. spathulata: aerial part of V. spathulata was collected from Gadouk pass, Firoozkouh Road, Savadkouh City (Mazandaran Province) in May 2017. The species were authenticated at the herbarium unit of the Department of Biology, School of Sciences (Sari Payame Noor University; Herbarium number: SPNH-4727). The aerial parts of V. spathulata were separately dried, powdered, and extracted with 70% ethanol in a Soxhlet apparatus for 48 hours. The hydroalcoholic extracts were then concentrated in a water bath and kept at -20ºC until use. All stages were conducted at the Research Institute of Medicinal Plants of Shahid Beheshti University [25].
Study design
Animals and group assignment: Sixty male Wistar albino rats (weight: 220-250 g) were selected for this study and divided into two major groups. The first major group is the healthy group that included groups number 1-5. The second major group is the Middle Cerebral Artery Occlusion (MCAO) group which are subdivided into groups number 6-10 (n=6 per each group). 1-5) Healthy+Four groups treated with normal saline, V. spathulata (5 and 10 mg/kg), L. album and U. dioica (100 mg/kg), respectively, 6) MCAO (middle cerebral artery occlusion) and 7-10) four MCAO groups treated by Normal Saline, V. spathulata (5, 10 mg/kg), L. album, and U. dioica (100 mg/kg), respectively. Pretreatment was done for 7-day before tests. The groups 6-10 had been operated on for 60 min period to establish Middle Cerebral Artery Occlusion (MCAO), and 24 hours after reperfusion, XBP-1 splicing was studied in the brain by Reverse Transcription-Polymerase Chain Reaction (RT-PCR).
Focal Cerebral Ischemia (MCAO): The rats were weighed and anesthetized with chloral hydrate (Merck, Germany) (400 mg/kg; IP). MCAO was performed as described by Longa et al. (1989) [26]. Briefly, under microscopic surgery, a 3-0 silicone-coated nylon (Nylon, homemade) suture was introduced through the external carotid artery stump. The occluder was advanced into the internal carotid artery 20-22 mm beyond the carotid bifurcation until mild resistance indicated that the tip lodged in the anterior cerebral artery and blocked the blood flow to the MCA [25]. Reperfusion started by withdrawing the suture after 60 min of ischemia. Rectal temperature was monitored (Citizen-513w, CITIZEN, United Arab Emirates) and maintained at 37°C by surface heating and cooling during surgery.
Molecular experiments: The splicing of the XBP-1 mRNA gene was investigated in the brain of the animals. All surgical instruments were sterilized and set DNase-RNase Free/Non-Pyrogen for surgical removal and separation of animal tissue. Small 10-mg pieces were isolated and frozen immediately after aseptic transfer to DNase-RNase Free/Non-Pyrogen sterile microtube. 
After brain extraction, the hippocampus was dissected under sterile-cold conditions and immediately transferred to a nitrogen tank. RNA was extracted based on acid guanidinium thiocyanate-phenol-chloroform extraction employing an RNX-Plus solution (EX 6101, Sina Clon, Iran), following the manufactures instructions. The total RNA extracted from the hippocampus tissue was converted into cDNA using a cDNA synthesis kit (YT 4500 and YTA, Iran).
The DNA and RNA of all prepared specimens were extracted using specific kits and according to the manufacturer’s guidelines. Finally, RT-PCR was performed in turn. Using the spectroscopic technique (NanoDrop-2000c Spectrophotometers, Thermo Fisher Scientific, USA), the purity of the extracted RNA was measured. Before cDNA synthesis from extracted RNAs, RNA samples were treated with DNAse specific kit (Sina Clon, Iran) to eliminate possible contamination with DNA. After treatment with a DNase-specific kit, the samples were subjected to RT-PCR (Thermo Fisher Scientific, USA). For the PCR, a sensitive and specific primer pair was used for the test and control groups [27]:
XBP-1 forward primer: 5`GAACCAGGAGTTAAGAACACG3`, and 
Reverse primer: 5`AGGCAACAGTGTCAGAGTCC3` 
(size of PCR product: unspliced uXBP-1=205 bp and spliced sXBP-1=179 bp) as described [27], and β-actin housekeeping primers were obtained from CinnaGen, Iran.
Statistical analysis
The results of this experiment were analyzed in IBM SPSS software v. 16. For comparing the spliced or unspliced XBP-1 mRNA gene in the studied groups, the χ2 test was utilized. For all tests, P<0.05 was considered statistically significant. The obtained data were expressed as Mean±SD.

Results

Three herbs were used for evaluating their effects on XBP-1 gene splicing in a male rat stroke model:
Effects of V. Spathulata on the XBP-1 gene splicing: In the healthy group (group 1), we had no XBP-1 gene splicing. In the MCAO group (group 6), all rats had spliced the XBP-1 gene. In the MCAO group treated with V. spathulata 5 (group 7), only two mice showed spliced XBP-1 gene, and this value was significantly lower than that in the MCAO group (P<0.05). In addition, in the MCAO group treated with V. spathulata 10 (group 8), only one rat had XBP-1 gene splicing (P<0.05). Treatment with V. spathulata 5 and V. spathulata 10 in healthy rats caused no XBP-1 gene splicing (groups 2 and 3) (Figure 1). 



Effects of L. album on XBP-1 gene Splicing: In the healthy group (group 1), we found no splicing XBP-1 gene. In the MCAO group (group 6), all rats had spliced XBP-1 gene. In the MCAO group treated with the L. album (group 9), only two rats had XBP-1 gene splicing (P<0.05). Treatment with L. album in the healthy rats stopped XBP-1 gene splicing (group 4) (Figure 2).



Effects of U. dioica on XBP-1 gene Splicing: In the healthy group (group 1), we had no XBP-1 gene splicing. In the MCAO group (group 6), all rats had spliced XBP-1 gene. In the MCAO group treated with the U. dioica (group 10), only two rats had XBP-1 gene splicing (P<0.05). Treatment with U. dioica in the healthy rats stopped XBP-1 gene splicing (group 5) (Figure 3). 


 

Discussion 

In the present study, we examined the probable neuroprotective effects of V. spathulate, L. album, and U. dioica on splicing of ER stress mRNA gene marker (X-box binding protein-1 [XBP-1]) and Unfolded Protein Response (UPR) activation in the brain of the rat stroke model. 
MCAO-induced ischemia caused a marked increase in XBP-1 splicing in all rats of the MCAO group compared to the control groups, and pretreatment with 3 herbal extracts dramatically decreased target gene splicing in the MCAO studied groups.
In the present study, we used a novel index to investigate and compare the effects of three herbs (V. spathulata, L. album; U. dioica) on the UPR response in vivo. 
Hypothetically, the ER stress in the eukaryotic endoplasmic reticulum results in the activation of the UPR in response to increased levels of miss-folded proteins. This effect will often indicate its presence, either in the form of an increase in the bioavailability of the living tissue and cells or causing the death of the cells and, ultimately, the subject [16]. To cause cell death, calcium overload of cells occurs in different ways [8, 9, 11-13, 15]. 
We looked at the effects of three different plant extracts on ER stress and altered XBP-1 mRNA gene transcripts splicing in the animal model of stroke. Normally, blood flow to the affected tissue is impaired, leading to hypoxia and regional tissue damage. One of the intracellular organelles involved in this event is the endoplasmic reticulum. In this study, the efficacy of three herbal extracts on strokes was investigated with changes in gene target editing. It was observed that one hour of closing the middle cerebral artery activated the splicing of the target gene, and the use of herbal extracts reduced ER stress.
Various herbal medicines have been used in previous studies to reduce the inflammatory effects and cellular stress caused by MCAO. Each method has advantages and disadvantages. Given the extent of the damage caused by MCAO, it is always necessary to find new treatment strategies.
This study showed that the use of V. spathulata at a dose of 5 and 10 mg/kg reduced the splicing of the target gene. This effect can be due to the presence of anti-inflammatory compounds like polyphenols and melatonin of the plant. In another study by Karimifar et al. [25], doses of 25, 50, and 75 mg/kg of Viola odorata extract were tested in a focal cerebral ischemic model of male rats. They observed that a 50 mg/kg dose of the extract could reduce infarct volume and neurological defects. Their reports were based on calculating Neurological Deficit Scores (NDS) and Infarct Volume (IV) in an MCAO stroke model. According to their investigation of IV in the core, penumbra, and subcortex, different doses of extract may lead to different score recordings in each anatomic area of the brain [25]. In the present study, this is the first time that the effectiveness of V. spathulata extract is measured by evaluating the mechanism of UPR. It is worth noting that the V. spathulata species is a native species of Iran, and there has not been much information about its effectiveness on the stroke.
The present study results show that U. dioica at a dose of 100 mg/kg reduced the target gene splicing. This effect can be due to the presence of antioxidant compounds of the U. dioica. The healing effect of U. dioica extract has already been evaluated for some disorders like experimental acute pancreatitis model in rats [28]or combination therapy of nettles with nonsteroidal anti-inflammatory drugs [29]. Although much research has been done on the role of the UPR mechanism in stroke, no study has been conducted on the effectiveness of nettle mechanisms in this way.
The use of Lamium at a dose of 100 mg/kg also reduced target gene splicing. This effect can be due to the presence of antioxidant compounds of the Lamium. The therapeutic effects of U. dioica and L. album extracts have previously been investigated in streptozotocin-induced diabetic rats. The assessment method evaluated the expression level of cyclooxygenase-2 and caspase-3 in the liver and kidney of rats [30]. In another study, the effects of combination therapy with U. dioica and L. album extracts were investigated on rat tracheal smooth muscle contraction [24]. Thus, the therapeutic efficacy of Lamium and its combination therapy have already been demonstrated. Nevertheless, no study has compared the therapeutic efficacy of the extract of these plants on the stroke animal model via UPR evaluation.
Examining the sensors of the UPR system and its transcription factor splicing (XBP-1) can be an indicator of the body’s hemostatic balance or deadly inflammatory responses. The more inflammation, the more splicing will occur in the XBP-1 gene of the UPR system. In the animal model group of strokes that received 5 mg/kg V. spathulata, only two rats presented with XBP-1 splicing and, in the stroke group treated with 10 mg/kg V. spathulata extract, only one rat had spliced XBP-1. In the animal model group of strokes that received L. album and U. dioica, only two rats had XBP-1 splicing. This study shows that the use of these plant extracts targets inflammatory mechanisms in the brain at the molecular level and can control some of the deadly cellular stress caused by strokes. Recent findings could confirm and suggest the neuroprotective effects of pretreatment with these herbal extracts to prevent stroke in sensitive or high-risk individuals. It is recommended that other tests be performed on other sensors in the UPR system to support this claim.

Conclusion

All three herbal extracts of V. spathulata, L. album, and U. dioica had the promising potential to use as a neuroprotective agent with diminished ER stress. Further study is needed to reveal more pathways that are mechanistic.

Ethical Considerations

Compliance with ethical guidelines

This study was approved by the Ethics Committee of Guilan University of Medical Sciences (IR.GUMS.REC.1395.161). All study procedures were done in compliance with the ethical guidelines of the Declaration of Helsinki, 2013.

Funding

This project was approved as a research project with the financial support of the Vice-Chancellor of Research and Technology, Guilan University of Medical Sciences (No.: 95052305). 

Authors' contributions

Conceptualization and methodology: All authors; Project administration: Mahmood Abedinzade, Ekram Mohammadi, Behrooz Khakpour Taleghani, and Korosh Khanaki; Acquisition: Mojtaba Hedayati, Ekram Mohammadi, and Mahmood Abedinzade; Formal analysis: Mojtaba Hedayati Ch, Mahmood Abedinzade, Behrooz Khakpour Taleghani, and Korosh Khanaki; Writing, review, and editing: Mojtaba Hedayati and Mahmood Abedinzade; Resources, data curation: Korosh Khanaki, Ekram Mohammadi, Behrooz Khakpour Taleghani, and Mostafa Golshekan. 

Conflict of interest

The authors declared no conflict of interest.


 

References

  1. Adams HP Jr, Bendixen BH, Kappelle LJ, Biller J, Love BB, Gordon DL, et al. Classification of subtype of acute ischemic stroke. Definitions for use in a multicenter clinical trial. TOAST. Trial of Org 10172 in Acute Stroke Treatment. Stroke. 1993; 24(1):35-41. [DOI:10.1161/01.STR.24.1.35] [PMID]
  2. Warner DS, Sheng H, Batinić-Haberle I. Oxidants, antioxidants and the ischemic brain. J Exp Biol. 2004; 207(Pt 18):3221-31. [DOI:10.1242/jeb.01022] [PMID]
  3. Lakhan SE, Kirchgessner A, Hofer M. Inflammatory mechanisms in ischemic stroke: Therapeutic approaches. J Transl Med. 2009; 7:97. [DOI:10.1186/1479-5876-7-97] [PMID] [PMCID]
  4. Wong CH, Crack PJ. Modulation of neuro-inflammation and vascular response by oxidative stress following cerebral ischemia-reperfusion injury. Curr Med Chem. 2008; 15(1):1-14. [DOI:10.2174/092986708783330665] [PMID]
  5. Sanderson TH, Gallaway M, Kumar R. Unfolding the unfolded protein response: Unique insights into brain ischemia. Int J Mol Sci. 2015; 16(4):7133-42. [DOI:10.3390/ijms16047133] [PMID] [PMCID]
  6. Badiola N, Penas C, Miñano-Molina A, Barneda-Zahonero B, Fadó R, Sánchez-Opazo G, et al. Induction of ER stress in response to oxygen-glucose deprivation of cortical cultures involves the activation of the PERK and IRE-1 pathways and of caspase-12. Cell Death Dis. 2011; 2(4):e149. [DOI:10.1038/cddis.2011.31] [PMID] [PMCID]
  7. Nakka VP, Gusain A, Raghubir R. Endoplasmic reticulum stress plays critical role in brain damage after cerebral ischemia/reperfusion in rats. Neurotox Res. 2010; 17(2):189-202. [DOI:10.1007/s12640-009-9110-5] [PMID]
  8. Badlou BA, Hedayati M, Abedinzade M, Golshekan M. Highlights about recent sepsis related studies. CPQ Medicine. 2020; 8(4):1-3. https://www.cientperiodique.com/article/CPQME-8-4-235.pdf
  9. Heydari S, Hedayati Ch M, Saadat F, Abedinzade M, Nikokar I, Aboutaleb E, et al. Diphtheria toxoid nanoparticles improve learning and memory impairment in animal model of Alzheimer’s disease. Pharmacol Rep. 2020; 72(4):814-26. [DOI:10.1007/s43440-019-00017-w] [PMID]
  10. Ovbiagele B, Kidwell CS, Starkman S, Saver JL. Potential role of neuroprotective agents in the treatment of patients with acute ischemic stroke. Curr Treat Options Cardiovasc Med. 2003; 5(6):441-9. [DOI:10.1007/s11936-003-0033-9] [PMID]
  11. Morteza-Semnani K, Saeedi M, Akbarzadeh M. Chemical composition of the essential oil of the flowering aerial parts of lamium album L. J Essent Oil Bearing Plants. 2016; 19(3):773-7. [DOI:10.1080/0972060X.2016.1168321]
  12. Matkowski A, Piotrowska M. Antioxidant and free radical scavenging activities of some medicinal plants from the Lamiaceae. Fitoterapia. 2006; 77(5):346-53. [DOI:10.1016/j.fitote.2006.04.004] [PMID]
  13. Topouzova-Hristova T, Moskova-Doumanova V, Keremidarska M, Doumanov J, Miteva G, Petkova B, et al. Anticancer effect of plant extracts from Lamium album L. By induction of cell death in vitro. Medicine. 2012; 2(1):55-9. http://www.sustz.com/journal/VolumeII/Number1/Papers/Topouzova-Hristova.pdf
  14. Khanaki K, Abedinzade M, Mohammadi M. The extract of Lamium album and Urtica dioica increase serum insulin-like growth factor 1 level in streptozotocin-induced diabetic rats. Zahedan J Res Med Sci. 2017; 19(12):e58054. [DOI:10.5812/zjrms.58054]
  15. Mehran MM, Norasfard MR, Abedinzade M, Khanaki K. Lamium album or Urtica dioica? Which is more effective in decreasing serum glucose, lipid and hepatic enzymes in streptozotocin induced diabetic rats: A comparative study. Afr J Tradit Complement Altern Med. 2015; 12(5):84-8. [DOI:10.4314/ajtcam.v12i5.13]
  16. Mohseni Mehran S, Norasfard M R, Abedinzade M, Khanaki K. [Comparison the effects of lamium album and urticadioicaonserum level of glucose and lipid profile in male diabetic rats (Persian)]. J Guilan Univ Med Sci. 2015; 24(93):47-53. http://journal.gums.ac.ir/article-1-942-en.html
  17. Roschek B Jr, Fink RC, McMichael M, Alberte RS. Nettle extract (Urtica dioica) affects key receptors and enzymes associated with allergic rhinitis. Phytother Res. 2009; 23(7):920-6. [DOI:10.1002/ptr.2763] [PMID]
  18. Kamkar A, Monfared M, Javan AJ, Asadi F, Aknodzadeh A. Antioxidative effects of liquid and organic extracts from Iranian nettle (Urtica dioica L.). Asian J Food Agro-Ind. 2010; 3(5):491-7. https://www.cabdirect.org/cabdirect/abstract/20113064970
  19. Ziyyat A, Legssyer A, Mekhfi H, Dassouli A, Serhrouchni M, Benjelloun W. Phytotherapy of hypertension and diabetes in oriental Morocco. J Ethnopharmacol. 1997; 58(1):45-54. [DOI:10.1016/S0378-8741(97)00077-9]
  20. Toldy A, Stadler K, Sasvári M, Jakus J, Jung KJ, Chung HY, et al. The effect of exercise and nettle supplementation on oxidative stress markers in the rat brain. Brain Res Bull. 2005; 65(6):487-93. [DOI:10.1016/j.brainresbull.2005.02.028] [PMID]
  21. Ansari M, Rafiee Kh, Yasa N, Vardasbi S, Naimi SM, Nowrouzi A. Measurement of melatonin in alcoholic and hot water extracts of Tanacetum parthenium, Tripleurospermum disciforme and Viola odorata. Daru. 2010; 18(3):173-8. [PMID] [PMCID]
  22. Liu LF, Qin Q, Qian ZH, Shi M, Deng QC, Zhu WP, et al. Protective effects of melatonin on ischemia-reperfusion induced myocardial damage and hemodynamic recovery in rats. Eur Rev Med Pharmacol Sci. 2014; 18(23):3681-6. [PMID]
  23. Letechipı́a-Vallejo G, González-Burgos I, Cervantes M. Neuroprotective effect of melatonin on brain damage induced by acute global cerebral ischemia in cats. Arch Med Res. 2001; 32(3):186-92. [DOI:10.1016/S0188-4409(01)00268-5] [PMID]
  24. Arefani S, Mehran SMM, Moladoust H, Norasfard MR, Ghorbani A, Abedinzade M. Effects of standardized extracts of Lamium album and Urtica dioica on rat tracheal smooth muscle contraction. J Pharmacopuncture. 2018; 21(2):70-5. [DOI:10.1016/S0188-4409(01)00268-5] [PMID] [PMCID]
  25. Karimifar K, Alipanah H, Bigdeli MR. [Effect of Viola odorata extract on reducing infarct volume and neurological defects in focal cerebral ischemia animal model (Persian)]. J Mazandaran Univ Med Sci. 2017; 27(148):1-11. http://jmums.mazums.ac.ir/article-1-9948-en.html
  26. Longa EZ, Weinstein PR, Carlson S, Cummins R. Reversible middle cerebral artery occlusion without craniectomy in rats. stroke 1989; 20(1):84-91. [DOI:10.1161/01.STR.20.1.84] [PMID]
  27. Samali A, Fitzgerald U, Deegan S, Gupta S. Methods for monitoring endoplasmic reticulum stress and the unfolded protein response. Int J Cell Biol. 2010; 2010:830307. [DOI:10.1155/2010/830307] [PMID] [PMCID]
  28. Yilmaz B, Basar Ö, Aktas B, Altinbas A, Ekiz F, Büyükcam F, et al. Effects of urtica dioica extract on experimental acute pancreatitis model in rats. Int J Clin Exp Med. 2014; 7(5):1313-8. [PMID] [PMCID]
  29. Kregiel D, Pawlikowska E, Antolak H. Urtica spp.: Ordinary plants with extraordinary properties. Molecules. 2018; 23(7):1664. [DOI:10.3390/molecules23071664] [PMID] [PMCID]
  30. Khanaki K, Abedinzade M, Hamidi M. The effects of urtica dioica and lamium album extracts on the expression level of cyclooxygenase-2 and caspase-3 in the liver and kidney of streptozotocin-induced diabetic rats. Pharm Sci. 2019; 25(1):37-43. [DOI:10.15171/PS.2019.6]
Type of Study: Research | Subject: Special
Received: 2021/08/25 | Accepted: 2021/07/7 | Published: 2021/07/7

Add your comments about this article : Your username or Email:
CAPTCHA

Send email to the article author


Rights and permissions
Creative Commons License This work is licensed under a Creative Commons Attribution-NonCommercial 4.0 International License.

© 2021 CC BY-NC 4.0 | Caspian Journal of Neurological Sciences

Designed & Developed by : Yektaweb